Ícone
Fotos / Sons
Nome da Espécie / Táxon
Observador
Lugar
Ações
Insects

Fotos / Sons

Qual

Insetos Classe Insecta

Observador

awenninger

Data

Setembro 28, 2020 05:40 PM AKDT

Descrição

Maybe a lilac bush? If so might be lilac leafminer?

Fotos / Sons

Observador

awenninger

Data

Setembro 23, 2020 05:27 PM AKDT

Fotos / Sons

Nenhuma foto ou som

Observador

awenninger

Data

Agosto 5, 2020 12:08 PM AKDT

Descrição

Sent in a leafmining moth to LifeScanner but it must have been contaminated, the ID came back as Chaitophorus populifolii. Host was balsam poplar. BOLD-DJ4, DNA sequence: COI-5P
AACTTTATATTTTTTATTCGGAATCTGATCAGGAATAATTGGATCTTCATTAAGAATTTTAATTCGATTAGAACTTAGACAAATTAATTCAATTANTAATAATAATCAATTATATAATGTTATTGTAACAATTCATGCATTTATTATAATTTTCTTTATAACAATACCTATCGTAATTGGAGGATTCGGAAATTGATTAATTCCTATAATAATAGGATGTCCTGACATATCATTTCCACGTTTAAATAATATTAGATTTTGAATATTACCACCCTCCCTAATAATAATAATTACAAGATTTATAATTAATAATGGAACAGGAACAGGATGAACAATTTATCCCCCATTATCAAATAATATTGCCCACAATAATATTTCAGTTGATCTAACTATTTTTTCATTACATTTAGCAGGAGTATCTTCTATTTTAGGAGCAATTAATTTTATTTGCACTATCTTAAATATAATACCCAATAACATAAAACTTAATCAAATCCCCCTTTTCCCTTGATCTATTTTAATTACAGCAATCTTATTAATCCTTTCATTACCTGTATTAGCAGGTGNTATTACAATACTATTAACTGATCGAAACCTAAATACTTCATTTTTCG-

Link to observation of leaf/mine from leafminer I had sent in: https://www.inaturalist.org/observations/55720746

Fotos / Sons

Observador

awenninger

Data

Setembro 17, 2020 07:22 PM AKDT

Descrição

Found in brown rice

Fotos / Sons

Square

Observador

awenninger

Data

Junho 10, 2020 11:25 AM AKDT

Descrição

Host: Betula neoalaskana. Family ID from LifeScanner. Vial BOLD-GE8. DNA sequence: COI-5P
TATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATACCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCGACCCTGCAGGAATAAGA-----------------

Fotos / Sons

Square

Observador

awenninger

Data

Junho 10, 2020 08:28 AM AKDT

Descrição

Host: Betula neoalaskana. Family ID from lifescanner. Lifescanner vial BOLD-ZR6. DNA sequence: COI-5P
GAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGGAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATACCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Fotos / Sons

Observador

awenninger

Data

Setembro 16, 2020 03:56 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 16, 2020 04:35 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 10, 2020 10:06 AM AKDT

Fotos / Sons

Square

Observador

awenninger

Data

Setembro 10, 2020 11:58 AM AKDT

Fotos / Sons

Qual

Vespas-de-Darwin Família Ichneumonidae

Observador

awenninger

Data

Setembro 10, 2020 11:57 AM AKDT

Fotos / Sons

Square

Observador

awenninger

Data

Setembro 10, 2020 12:30 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 10, 2020 10:06 AM AKDT

Fotos / Sons

Qual

Tordo-Variegado Ixoreus naevius

Observador

awenninger

Data

Setembro 10, 2020 12:07 PM AKDT

Descrição

Found dead

Fotos / Sons

Observador

awenninger

Data

Setembro 10, 2020 01:43 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 10, 2020 01:41 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 10, 2020 01:41 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 10, 2020 01:13 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 9, 2020 07:52 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 9, 2020 07:54 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Setembro 5, 2020 06:31 PM AKDT

Fotos / Sons

Square

Observador

awenninger

Data

Agosto 31, 2020 06:12 PM AKDT

Fotos / Sons

Square

Observador

awenninger

Data

Setembro 1, 2020 09:26 AM AKDT

Fotos / Sons

Observador

awenninger

Data

Agosto 31, 2020 07:55 PM AKDT
Birds

Fotos / Sons

Square

Qual

Aves Classe Aves

Observador

awenninger

Data

Agosto 31, 2020 02:50 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Agosto 31, 2020 02:22 PM AKDT

Descrição

On Sitka or Siberian alder

Fotos / Sons

Square

Observador

awenninger

Data

Agosto 31, 2020 02:09 PM AKDT

Fotos / Sons

Observador

awenninger

Data

Agosto 31, 2020 01:34 PM AKDT

Descrição

On sitka or Siberian alder

Fotos / Sons

Square

Observador

awenninger

Data

Setembro 1, 2020 09:27 AM AKDT

Fotos / Sons

Square

Observador

awenninger

Data

Setembro 1, 2020 09:28 AM AKDT
Feeds: Átomo