Fotos / Sons

Observador

jgw_atx

Data

Setembro 27, 2021 11:04 AM CDT

Descrição

Exploring Justicia spicigera (Mexican Honeysuckle)

Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 27 de setembro de 2021
Concordante

Fotos / Sons

Observador

raycama

Data

Setembro 2021
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 27 de setembro de 2021
Principal

Fotos / Sons

Observador

buggggssss

Data

Agosto 18, 2021 04:32 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 25 de setembro de 2021
Principal

Fotos / Sons

Observador

gillessanmartin

Data

Novembro 27, 2018 05:47 PM CET

Descrição

Dolichomitus mesocentrus (Hymenoptera, Ichneumonidae).
Identification based on COI sequencing.

Location : Baillonville, Belgium ( Lat 50.30261 Long 5.34629)

Observation date : 2018-11-16 (OWSF sample)
Under the bark of Pinus sylvestris along with pissodes larvae.

Consensus and clipped sequence for COI from LCO/HCO primers :

ATTYTTGGAATATGAGCAGGAATAATTGGATCTTCAATAAGA
ATTATTATTCGATTAGAATTAGGAAATCCAGGATTTTTAATTAATAATGATCAAATTTAT
AATTCAATTGTTACTGCACATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATA
ATTGGTGGATTTGGAAATTGATTAGTACCTTTAATAATTGGAGCCCCAGATATAGCATTC
CCACGAATAAATAATATAAGATTTTGATTACTTCCTCCCTCTATTTTATTATTAATTTTT
AGAAGAATTACAAATCAAGGAGTAGGGACAGGCTGAACAGTTTATCCTCCTTTATCTTTA
AATTTAAATCATGAAGGTATATCTGTTGATTTAGCTATTTTCTCTTTACATATAACAGGT
ATATCATCAATTATAGGAGCAATTAATTTTATTACTACTATTTTAAATATACGACCTAAT
ATAATTAACTTAGAAAAAATATCTTTATTTACTTGATCTATCAAAATTACTGCAATTTTA
TTACTACTCGCAGTCCCAGTATTAGCTGGTGCTATTACTATATTATTAACCGACCGAAAT
TTAAATACCTCATTTTTTGACCCTTCTGGGGGTGGTGACCC

Dolichomitus mesocentrus : 100% similarity with 3 specimens (Bold Systems 2019-04-01)

Consensus and clipped sequence for COI from CIJ/CIN primers :

TKGRRSCCCAGATATAGCATTCCCACGAATAAATAAT
ATAAGATTTTGATTACTTCCTCCCTCTATTTTATTATTAATTTTTAGAAGAATTACAAAT
CAAGGAGTAGGGACAGGCTGAACAGTTTATCCTCCTTTATCTTTAAATTTAAATCATGAA
GGTATATCTGTTGATTTAGCTATTTTCTCTTTACATATAACAGGTATATCATCAATTATA
GGAGCAATTAATTTTATTACTACTATTTTAAATATACGACCTAATATAATTAACTTAGAA
AAAATATCTTTATTTACTTGATCTATCAAAATTACTGCAATTTTATTACTACTCGCAGTC
CCAGTATTAGCTGGTGCTATTACTATATTATTAACCGACCGAAATTTAAATACCTCATTT
TTTGACCCTTCTGGGGGTGGTGACCCAATCTTATATCAACATTTATTTTGAT

Dolichomitus mesocentrus : 100% similarity with 3 specimens (Bold Systems 2019-04-01)

Dolichomitus mesocentrus - Photo (c) Gilles San Martin, alguns direitos reservados (CC BY-SA)
Identificação de zygy: Dolichomitus mesocentrus, um membro de Vespas-de-Darwin (Família Ichneumonidae)
Adicionado em 25 de setembro de 2021
Concordante

Fotos / Sons

Observador

gillessanmartin

Data

Maio 20, 2019

Descrição

Psoricoptera gibbosella caterpillar on oak (Quercus sp.)

ID based on barcoding :
CRAW_ID : AB2019_03_A004_01
Consensus and clipped sequence for COI from LCO/HCO primers :

ATTTTATTTTTGGAATTTGA-GCAGGTATAGT TGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTCTTACTTTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCTCATGGTGGTAGATCAGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATAAAAATTAATGGATTATCTTTTGATCAAATACCCCTATTTGTTTGAGCAGTAGGAATTACCGCTTTATTACTACTTTTATCTCTTCCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACCTCATTCTTTGATCCTGCAGGAGGAGGAGATC

Psoricoptera gibbosella - Photo (c) Drepanostoma, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Psoricoptera gibbosella, um membro de Borboletas e Mariposas (Ordem Lepidoptera)
Adicionado em 24 de setembro de 2021
Concordante

Fotos / Sons

Observador

jakemccumber

Data

Setembro 20, 2021 02:45 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 22 de setembro de 2021
Concordante

Fotos / Sons

Observador

mlankford

Data

Setembro 19, 2021 03:51 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 20 de setembro de 2021
Concordante

Fotos / Sons

Observador

mlankford

Data

Setembro 19, 2021 03:34 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 20 de setembro de 2021
Concordante

Fotos / Sons

Observador

imasongster

Data

Setembro 16, 2021 11:49 AM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 17 de setembro de 2021
Concordante

Fotos / Sons

Observador

giffbeaton

Data

Agosto 8, 2021 09:07 AM EDT
Hentzia palmarum - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Hentzia palmarum, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 15 de setembro de 2021
Concordante

Fotos / Sons

Observador

giffbeaton

Data

Agosto 8, 2021 09:09 AM EDT

Descrição

Another gray one @zygy

Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 14 de setembro de 2021
Concordante

Fotos / Sons

Observador

giffbeaton

Data

Agosto 7, 2021 04:50 PM EDT
Anasaitis canosa - Photo (c) David Hill, alguns direitos reservados (CC BY)
Identificação de zygy: Anasaitis canosa, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 13 de setembro de 2021
Concordante

Fotos / Sons

Observador

franklinhowley

Data

Outubro 11, 2020 05:20 PM UTC
Anasaitis locuples - Photo (c) Joshua LaPergola, alguns direitos reservados (CC BY-NC-SA)
Identificação de zygy: Anasaitis locuples, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 13 de setembro de 2021
Concordante

Fotos / Sons

Observador

tshahan

Data

Setembro 2014

Lugar

Belize (Google, OSM)

Descrição

dates approximate

Zygoballus - Photo (c) Clarence Holmes, todos os direitos reservados
Identificação de zygy: Género Zygoballus, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 09 de setembro de 2021
Concordante

Fotos / Sons

What

Papa-Moscas (Família Salticidae)

Observador

reecethelen

Data

Setembro 2, 2021 08:44 AM EDT
Papa-Moscas - Photo (c) Philip Herbst, todos os direitos reservados
Identificação de zygy: Papa-Moscas (Família Salticidae)
Adicionado em 09 de setembro de 2021
A melhorar

Fotos / Sons

Observador

caseygirard

Data

Setembro 7, 2021 09:59 AM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 07 de setembro de 2021
Concordante

Fotos / Sons

Observador

mlankford

Data

Setembro 3, 2021 06:16 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 04 de setembro de 2021
Concordante

Fotos / Sons

Observador

benjamin189

Data

Agosto 28, 2021 05:58 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 31 de agosto de 2021
Concordante

Fotos / Sons

Observador

tlhunter

Data

Agosto 2021
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 30 de agosto de 2021
Concordante

Fotos / Sons

Observador

mmoerdyk

Data

Agosto 26, 2021 08:06 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 27 de agosto de 2021
Concordante

Fotos / Sons

Observador

nashuagoats

Data

Agosto 4, 2020 09:40 AM EDT
Zygoballus sexpunctatus - Photo Kaldari, sem restrições de direitos de autor conhecidas (domínio público)
Identificação de zygy: Zygoballus sexpunctatus, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 25 de agosto de 2021
Concordante

Fotos / Sons

Observador

neilgunther

Data

Agosto 21, 2021 05:56 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 25 de agosto de 2021
Concordante

Fotos / Sons

Observador

anna120

Data

Agosto 2021
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 25 de agosto de 2021
Concordante

Fotos / Sons

Observador

imasongster

Data

Agosto 24, 2021 03:27 PM EDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 25 de agosto de 2021
Concordante

Fotos / Sons

Observador

sambiology

Data

Agosto 25, 2021 08:26 AM CDT

Descrição

Had a wonderful morning out at LLELA with Karen and Haley -- we went out to document some bugs (and everything!) on Haley's research plot. Loads of fun. :)

Zygoballus sexpunctatus - Photo Kaldari, sem restrições de direitos de autor conhecidas (domínio público)
Identificação de zygy: Zygoballus sexpunctatus, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 25 de agosto de 2021
Principal

Fotos / Sons

Observador

sciknox

Data

Agosto 2021
Scudderia - Photo (c) Nick Block, alguns direitos reservados (CC BY)
Identificação de zygy: Género Scudderia, um membro de Esperanças (Família Tettigoniidae)
Adicionado em 25 de agosto de 2021
A melhorar

Fotos / Sons

Observador

gilberto1859

Data

Agosto 15, 2021 06:26 PM CDT
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 22 de agosto de 2021
Concordante

Fotos / Sons

Observador

oditidevak

Data

Agosto 14, 2021 05:11 PM UTC
Zygoballus - Photo (c) Clarence Holmes, todos os direitos reservados
Identificação de zygy: Género Zygoballus, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 20 de agosto de 2021
A melhorar

Fotos / Sons

Observador

tshahan

Data

Agosto 2021
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 20 de agosto de 2021
Principal

Fotos / Sons

Observador

rynxs

Data

Agosto 2021
Zygoballus rufipes - Photo (c) Buddy, alguns direitos reservados (CC BY-NC)
Identificação de zygy: Zygoballus rufipes, um membro de Papa-Moscas (Subfamília Salticinae)
Adicionado em 14 de agosto de 2021
Concordante

Estatísticas

  • 1519