Fotos / Sons

Observador

murugesann

Data

Agosto 21, 2021 08:15 PM IST

Fotos / Sons

What

Orangutango-Do-Bornéu Pongo pygmaeus

Observador

budak

Data

Setembro 2009

Fotos / Sons

Data

Maio 28, 2011 04:57 PM IST

Descrição

Observer: Sanjeev Kumar

Fotos / Sons

Observador

valehu

Data

Maio 2021

Fotos / Sons

Observador

rundvm1

Data

Abril 30, 2021 11:08 AM EDT

Fotos / Sons

What

Junco-Comum Junco hyemalis

Observador

carrieseltzer

Data

Fevereiro 21, 2021 01:40 PM EST

Fotos / Sons

Observador

amanda222

Data

Agosto 2018

Fotos / Sons

Observador

maryeford

Data

Outubro 2, 2014 02:15 PM EDT

Fotos / Sons

Observador

maryeford

Data

Outubro 12, 2015 03:24 PM EDT

Fotos / Sons

Observador

danielraju

Data

Março 15, 2017

Fotos / Sons

Observador

ronithurs

Data

Junho 25, 2020 08:30 AM IST

Descrição

Found a pair of Grey Slender Loris hiding in the thick canopy of a tree, got decent views

Fotos / Sons

What

Orangutango-Do-Bornéu Pongo pygmaeus

Observador

gery-dupas

Data

Novembro 2015

Fotos / Sons

Observador

carrieseltzer

Data

Maio 2020

Descrição

Well, this is one of the stranger wildlife interactions I’ve had in my yard. I’m sitting out here working with my laptop and a bag of M&Ms and this butterfly flies towards me and goes straight for the bag. I stare in disbelief as it climbs in, fumble for my phone, and snap a few shots before it climbs out and flies away.

Fotos / Sons

What

Abelha-Carpinteira-Violeta Xylocopa violacea

Observador

wenzel_sylvester

Data

Agosto 19, 2016 02:22 PM CEST

Fotos / Sons

What

Salamandra-Viscosa-de-Pintas-Brancas Plethodon cylindraceus

Observador

lucareptile

Data

Abril 2020

Descrição

First record of this species in Arlington County since 1977. Adult female found under a log in an upland area dominated by mountain laurel, similar to the habitat I’ve found this species in elsewhere in northern Virginia. This was in a park that has been extensively surveyed, yet there aren’t even any historical records of this species from this park. Absolutely amazing to find this species somewhere it has gone undetected for all this time.

Fotos / Sons

What

Veado-da-Virgínia Odocoileus virginianus

Observador

jamesdunbar

Data

Maio 15, 2019 09:23 AM UTC

Fotos / Sons

Observador

cccrll

Data

Julho 2014

Fotos / Sons

What

Pica-Pau-de-Ventre-Vermelho Melanerpes carolinus

Observador

jamesspitznas

Data

Setembro 19, 2019 08:31 AM EDT

Fotos / Sons

What

Esquilo-Terrestre-da-Califórnia Otospermophilus beecheyi

Observador

jamesspitznas

Data

Agosto 9, 2010 08:46 AM EDT

Fotos / Sons

What

Gavião-Peneira Elanus leucurus

Observador

jamesspitznas

Data

Agosto 9, 2010 05:45 PM EDT

Fotos / Sons

What

Leão-Marinho-da-Califórnia Zalophus californianus

Observador

jamesspitznas

Data

Janeiro 28, 2011 02:51 PM EST

Fotos / Sons

What

Seixoeira Calidris canutus

Observador

jamesspitznas

Data

Janeiro 28, 2011 03:57 PM EST

Fotos / Sons

Observador

jamesspitznas

Data

Setembro 10, 2010 08:13 AM EDT

Descrição

Vesper Sparrow - Pooecetes gramineus

Fotos / Sons

What

Pato-Rabilongo Clangula hyemalis

Observador

jamesspitznas

Data

Janeiro 1, 2020 10:22 AM EST

Descrição

Long-tailed Duck (male, non-breeding) - Clangula hyemalis

Fotos / Sons

What

Piadeira-Americana Mareca americana

Observador

jamesspitznas

Data

Janeiro 1, 2020 12:12 PM EST

Descrição

American Wigeon Duck - Anas americana

Fotos / Sons

What

Tico-Tico-Musical Melospiza melodia

Observador

jamesspitznas

Data

Setembro 29, 2019 07:52 AM EDT

Fotos / Sons

What

Beija-Flor-de-Allen Selasphorus sasin

Observador

jamesspitznas

Data

Novembro 3, 2019 11:39 AM EST

Fotos / Sons

Observador

acmicrobiology

Data

Dezembro 3, 2019 02:12 PM EST

Descrição

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Fotos / Sons

Observador

acmicrobiology

Data

Dezembro 3, 2019 02:12 PM EST

Descrição

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Fotos / Sons

What

Tarambola-Cinzenta Pluvialis squatarola

Observador

jamesspitznas

Data

Novembro 2, 2019 08:29 PM EDT

Descrição

Black-bellied Plover (non-breeding) - Pluvialis squatarola

Fotos / Sons

What

Borrelho-de-Coleira-Dupla Charadrius vociferus

Observador

jamesspitznas

Data

Novembro 3, 2019 02:14 PM EST

Fotos / Sons

What

Mergulhão-de-Cara-Preta Aechmophorus occidentalis

Observador

jamesspitznas

Data

Novembro 3, 2019 11:12 AM EST

Fotos / Sons

What

Mergulhão-Caçador Podilymbus podiceps

Observador

jamesspitznas

Data

Novembro 3, 2019 11:07 AM EST

Fotos / Sons

What

Goraz Nycticorax nycticorax

Observador

jamesspitznas

Data

Novembro 8, 2019 11:06 AM EST

Fotos / Sons

What

Goraz Nycticorax nycticorax

Observador

jamesspitznas

Data

Novembro 7, 2019 08:41 PM EST

Lugar

Lindo Lake (Google, OSM)

Fotos / Sons

What

Goraz Nycticorax nycticorax

Observador

jamesspitznas

Data

Novembro 7, 2019 07:57 PM EST

Lugar

Lindo Lake (Google, OSM)

Fotos / Sons

What

Goraz Nycticorax nycticorax

Observador

jamesspitznas

Data

Novembro 3, 2019 11:23 AM EST

Fotos / Sons

Observador

aphaywood

Data

Novembro 18, 2019 11:35 AM IST

Fotos / Sons

What

Garça-Real-Americana Ardea herodias

Observador

jamesspitznas

Data

Novembro 2, 2019 07:38 PM EDT

Fotos / Sons

What

Garça-Vermelha Egretta rufescens

Observador

jamesspitznas

Data

Novembro 8, 2019 11:58 AM EST

Fotos / Sons

Observador

jamesspitznas

Data

Agosto 27, 2019 05:01 AM EDT

Fotos / Sons

What

Suiriri-Valente Tyrannus tyrannus

Observador

jamesspitznas

Data

Julho 26, 2019 08:33 AM EDT

Descrição

Eastern Kingbird [Flycatcher] - Tyrannus tyrannus

Fotos / Sons

What

Garçote-Verde Butorides virescens

Observador

jamesspitznas

Data

Julho 26, 2019 08:30 AM EDT

Fotos / Sons

What

Garçote-Verde Butorides virescens

Observador

jamesspitznas

Data

Julho 26, 2019 09:57 AM EDT

Descrição

Green Heron - Butorides virescens

Fotos / Sons

What

Graúna-d'Asa-Vermelha Agelaius phoeniceus

Observador

jamesspitznas

Data

Julho 26, 2019 08:16 AM EDT

Fotos / Sons

What

Lesma-Leopardo Limax maximus

Observador

jamesspitznas

Data

Julho 3, 2019 05:03 AM EDT

Fotos / Sons

What

Andorinha-Das-Aves Tachycineta bicolor

Observador

jamesspitznas

Data

Abril 21, 2019 09:46 AM EDT

Fotos / Sons

What

Pipilo-d'Olho-Vermelho Pipilo erythrophthalmus

Observador

jamesspitznas

Data

Junho 27, 2019 04:26 PM EDT

Fotos / Sons

What

Azulão-Oriental Sialia sialis

Observador

jamesspitznas

Data

Maio 24, 2019 09:45 AM EDT

Descrição

Eastern Bluebird (female) - Sialia sialis

Fotos / Sons

What

Azulão-Oriental Sialia sialis

Observador

jamesspitznas

Data

Maio 24, 2019 09:15 AM EDT

Descrição

Eastern Bluebird (male) - Sialia sialis

Fotos / Sons

What

Garajau-Comum Sterna hirundo

Observador

congonaturalist

Data

Junho 18, 2019 12:05 PM EDT

Descrição

Catching a fish

Fotos / Sons

What

Tartaruga-Mordedora Chelydra serpentina

Observador

jamesspitznas

Data

Maio 24, 2019 08:27 AM EDT

Etiquetas

Fotos / Sons

What

Leopardo-Africano Panthera pardus ssp. pardus

Observador

evan81

Data

Abril 2019

Fotos / Sons

What

Gavião-Tesoura Elanoides forficatus

Observador

alyssacritters

Data

Abril 29, 2019 06:34 PM EDT

Descrição

Heard the kite smack into a tree branch and didn't realize what it was doing until it dropped this guy from above!

Fotos / Sons

What

Garça-Real-Americana Ardea herodias

Observador

jamesspitznas

Data

Abril 21, 2019 09:01 AM EDT

Fotos / Sons

What

Mariquita-de-Coroa-Ruiva Seiurus aurocapilla

Observador

jamesspitznas

Data

Abril 21, 2019 10:27 AM EDT

Fotos / Sons

What

Chopim-Mulato Molothrus ater

Observador

jamesspitznas

Data

Abril 21, 2019 08:13 AM EDT

Fotos / Sons

What

Andorinha-Das-Aves Tachycineta bicolor

Observador

jamesspitznas

Data

Março 31, 2019 06:26 PM EDT

Fotos / Sons

What

Mobelha-Grande Gavia immer

Observador

jamesspitznas

Data

Março 31, 2019 07:01 PM EDT

Fotos / Sons

What

Ganso-Do-Canadá Branta canadensis

Observador

jamesspitznas

Data

Março 31, 2019 06:46 PM EDT

Fotos / Sons

What

Tartaruga-da-Flórida Trachemys scripta

Observador

jamesspitznas

Data

Abril 1, 2019 05:23 PM EDT

Fotos / Sons

Observador

jamesspitznas

Data

Abril 3, 2019 05:36 PM EDT

Fotos / Sons

What

Anhinga Anhinga anhinga

Observador

carrieseltzer

Data

Março 29, 2019 05:21 PM EDT

Fotos / Sons

What

Pato-Carolino Aix sponsa

Observador

jamesspitznas

Data

Março 1, 2019 08:59 PM EST

Fotos / Sons

What

Garça-Branca-Americana Egretta thula

Observador

jamesspitznas

Data

Fevereiro 25, 2019 09:29 PM EST

Etiquetas

Fotos / Sons

What

Goraz Nycticorax nycticorax

Observador

jamesspitznas

Data

Fevereiro 25, 2019 09:12 PM EST

Descrição

Black-crowned Night-Heron - Nycticorax nycticorax

Fotos / Sons

What

Camão-Americano Porphyrio martinica

Observador

tomdriscoll

Data

Fevereiro 14, 2019 10:40 AM EST

Fotos / Sons

Observador

rhjackso

Data

Fevereiro 28, 2019 03:24 PM PST

Fotos / Sons

What

Maçarico-de-Costas-Brancas Limnodromus griseus

Observador

josh_vandermeulen

Data

Maio 10, 2015 02:25 PM EDT

Fotos / Sons

Observador

manuelbecerril

Data

Janeiro 4, 2019

Lugar

Tlalpan (Google, OSM)

Descrição

Macho.

Fotos / Sons

What

Mariquita-Coroada Setophaga coronata

Observador

uzun

Data

Janeiro 4, 2019 09:25 AM PST

Fotos / Sons

What

Mariquita-Coroada Setophaga coronata

Observador

mattk561

Data

Dezembro 13, 2018 09:06 AM PST

Descrição

Bobelaine Sanctuary

Fotos / Sons

What

Azulão-Oriental Sialia sialis

Observador

jamesspitznas

Data

Dezembro 1, 2018 09:31 AM EST

Fotos / Sons

What

Pica-Pau-de-Ventre-Vermelho Melanerpes carolinus

Observador

jariemames

Data

Novembro 27, 2018 11:01 AM EST

Fotos / Sons

What

Mariquita-de-Barrete-Castanho Setophaga palmarum

Observador

jariemames

Data

Novembro 27, 2018 11:03 AM EST

Fotos / Sons

What

Goraz Nycticorax nycticorax

Observador

avocat

Data

Novembro 3, 2018 04:48 PM PDT

Fotos / Sons

Observador

bob15noble

Data

Julho 30, 2018 01:16 PM EDT

Fotos / Sons

Observador

ivanvershynin03

Data

Novembro 3, 2018 02:31 PM PDT

Fotos / Sons

What

Azulão-Oriental Sialia sialis

Observador

jamesspitznas

Data

Setembro 3, 2018 09:33 AM EDT

Descrição

Eastern Bluebird [Thrush] - Sialia sialis

Fotos / Sons

What

Pilrito-Anão Calidris minutilla

Observador

wayne_fidler

Data

Agosto 29, 2018 12:26 PM EDT

Fotos / Sons

What

Sanhaço-de-Encontro-Branco Thraupis episcopus

Observador

kenchamberlain

Data

Janeiro 31, 2015 05:36 AM PST

Fotos / Sons

What

Saíra-Beija-Flor Cyanerpes cyaneus

Observador

kenchamberlain

Data

Janeiro 31, 2015 05:44 AM PST

Fotos / Sons

What

Sanhaço-de-Dorso-Listrado Piranga bidentata

Observador

kenchamberlain

Data

Janeiro 31, 2015 05:32 AM PST

Fotos / Sons

What

Sanhaço-de-Dorso-Listrado Piranga bidentata

Observador

kenchamberlain

Data

Janeiro 31, 2015 11:21 AM PST

Fotos / Sons

What

Sabiá-Setentrional Mimus polyglottos

Observador

kalamurphyking

Data

Setembro 29, 2015 01:51 PM CDT

Descrição

Photo 1: Mockingbirds don't eat my birdseed but they love my bird bath.
Photo 2: I was being very still but this look happened when one of my cats jumped up on the window sill to see what was out there. Check out the tiny little water drops on the tail.
Photo 3: In the middle of the bath it just sat and soaked for a minute.
Photo 4: This was taken a moment before it flew up into a tree to preen and dry off.

Fotos / Sons

What

Bisonte-Americano Bison bison

Observador

brenbarr

Data

Julho 19, 2018 07:59 AM MDT

Fotos / Sons

What

Picoteiro-Americano Bombycilla cedrorum

Observador

dpdawes

Data

Julho 1, 2018 07:13 PM EDT

Fotos / Sons

What

Mariquita-de-Mascarilha Geothlypis trichas

Observador

dpdawes

Data

Julho 1, 2018 07:29 PM EDT

Fotos / Sons

What

Mandriões Género Stercorarius

Observador

liam1294

Data

Maio 15, 2018 04:49 PM UTC

Fotos / Sons

Observador

aepigmenio

Data

Junho 11, 2018 12:40 PM CDT

Fotos / Sons

What

Aranhas Orbitelares Família Araneidae

Observador

jamesspitznas

Data

Junho 29, 2018 06:58 AM EDT

Etiquetas

Fotos / Sons

What

Colibri-Abelha Mellisuga helenae

Observador

markconboy

Data

Março 2017

Fotos / Sons

What

Corrupião-Dos-Pomares Icterus spurius

Observador

jpaiero

Data

Junho 26, 2018 06:13 PM EDT

Fotos / Sons

What

Frango-d'Água-de-Ridgway Rallus obsoletus

Observador

jamesspitznas

Data

Maio 20, 2018 07:49 PM EDT

Fotos / Sons

What

Águia-Pesqueira Pandion haliaetus

Observador

jamesspitznas

Data

Maio 20, 2018 08:46 PM EDT

Fotos / Sons

Observador

jamesspitznas

Data

Abril 23, 2018 10:57 AM PDT

Fotos / Sons

What

Cobra-Marrom Storeria dekayi

Observador

jfrancis

Data

Novembro 24, 2016 02:51 PM EST

Descrição

In driveway stationery. Approx 12" long.

Fotos / Sons

What

Cauré Falco rufigularis

Observador

panza_rayada

Data

Março 1, 2015 01:07 PM CST

Fotos / Sons

Observador

carrieseltzer

Data

Junho 9, 2016 05:34 PM PDT

Fotos / Sons

What

Pigargo-Americano Haliaeetus leucocephalus

Observador

nanorca13

Data

Junho 18, 2016 12:41 PM PDT

Descrição

Young eagle being dive bombed by crow.