Fotos / Sons

Observador

teellbee

Data

Maio 2, 2022 12:15 PM PDT

Fotos / Sons

What

Beija-Flor-de-Anna (Calypte anna)

Observador

lilbabybaba

Data

Abril 30, 2022 04:35 PM PDT

Fotos / Sons

Observador

catchang

Data

Maio 2, 2022 07:20 PM PDT

Fotos / Sons

Observador

christophermartin1

Data

Junho 13, 2021 07:16 PM PDT

Fotos / Sons

Observador

ryanphelansf

Data

Agosto 16, 2021 01:10 PM UTC

Descrição

Appears to have an egg bundle suspended in its web

Macro photos courtesy of @rhiannonsf

Fotos / Sons

What

Viúva-Negra-Ocidental (Latrodectus hesperus)

Observador

spencer_holmes

Data

Agosto 16, 2021 01:08 PM PDT

Fotos / Sons

Observador

quiverquercus

Data

Abril 25, 2021 06:23 PM PDT

Fotos / Sons

Observador

alexandre164

Data

Julho 17, 2021 02:05 PM UTC

Fotos / Sons

What

Vertebrados (Subfilo Vertebrata)

Observador

birdingman

Data

Abril 20, 2021 04:49 AM PDT

Descrição

eBird reviewer said it wasn't a bird. Any mammal experts out there have an idea?

Fotos / Sons

Observador

natashaelisa

Data

Janeiro 2021

Fotos / Sons

Observador

brennanpopovic

Data

Janeiro 12, 2021 04:47 PM UTC

Fotos / Sons

Observador

michael_maydeck

Data

Janeiro 15, 2021 01:31 PM UTC

Descrição

Found under brush on a bank along the trail.

Fotos / Sons

Observador

pogon

Data

Janeiro 5, 2021 11:12 AM PST

Descrição

on oak

Fotos / Sons

Observador

tparkeressig

Data

Março 12, 2019 05:16 PM UTC

Descrição

Managed to help it out of the large pot it had got trapped in.

Fotos / Sons

Observador

pogon

Data

Outubro 17, 2020 09:30 AM PDT

Descrição

In Tilden Park on dead Bay Laural. I originally thought it was a Stereum sp. but it looked a little different, and the host was usual. The specimen, which was almost completely resupinate, pealed off easily from the wood. The first photo is the dried specimen, the next two are dissection scope views. Cystidia are at 400X, spores at 1000X. Spores 7 X 11 (ave of 5), with a transparent outer part. Cystidia numerous, thickwalled, and incrusted with crystals. Clamp connections occasional. The ITS sequence is a nearly exact match:
AAGGATCATTAACGAGTCTTGAAAGGGTTGTAGCTGGCCTCCCGAGGCACGTGCACGCCCGCTCATCCGCTCTACACCTGTGCACCATTGTAGGTCGGTCGTGCGGGCGCCCCTCTTCTGGGGCGCTCGAGCGGTCTTCCTATGTAACACCACACACCATGCAGTATCGGAACGACGACGCGATAATACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAACCCCTATCCCTTGTGGAGAGCGGGCTTGGACTTGGAGGCTTGCCGGCCGTCGTGGTCGGCTCCTCTCGAATGCATCAGCTCGATTCCTTGCGGATCGGCTCTCGGCGTGATAATTGTCTACGTCGTGACCGTGAAGCGTCTGGCGGGCTTCTAACCGTCCCTTCGAGGACAACCCTTCGAATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Fotos / Sons

Observador

alan_rockefeller

Data

Dezembro 22, 2020 07:17 PM PST

Descrição

Stems and caps somewhat fluorescent in 365 nanometer ultraviolet light. Spores not so much, but young gills glow brightly.

Fotos / Sons

Observador

julietlee

Data

Dezembro 23, 2020 06:26 PM PST

Descrição

bioluminescent gills

Fotos / Sons

Observador

leftcoastnaturalist

Data

Outubro 2017

Descrição

Natural History of UCSC Campus, Fall 2017, Professor Ryan Carle

Etiquetas

Fotos / Sons

Observador

whitetail14

Data

Abril 18, 2020 08:04 PM UTC

Lugar

Jamestown (Google, OSM)

Fotos / Sons

Observador

leptonia

Data

Janeiro 22, 2020 03:50 PM PST

Fotos / Sons

Observador

evangerardo

Data

Janeiro 30, 2020 11:30 AM PST

Fotos / Sons

Observador

maggief

Data

Dezembro 22, 2019 11:21 AM HST

Fotos / Sons

What

Bassarisco (Bassariscus astutus)

Observador

rmyoshihara

Data

Julho 31, 2014 11:51 AM PDT

Descrição

Update on 1/27/2020:
The habitat was a wooded riparian strip along a levee adjacent to agricultural fields at the edge of the Sacramento Bypass Wildlife Area.

Three photos have been added

Fotos / Sons

Observador

milavth

Data

Dezembro 15, 2019 11:16 AM PST

Fotos / Sons

Observador

flygrl67

Data

Dezembro 2018

Descrição

When I cut it in half it quickly stained dark blue. Later that evening the blue disappeared, however it reappeared again when I scraped it with a knife. The odor and taste of both the cap and stipe were mild and indistinct. It was medium firm and was moist, but not at all slimy.

Fotos / Sons

Observador

leftcoastnaturalist

Data

Abril 24, 2014 12:23 PM PDT

Fotos / Sons

Observador

rkharwood

Data

Abril 2014

Descrição

A family of San Joaquin Kit foxes including an adult male and female with 6 pups was seen on 2 consecutive days. A photo is of a pup with a Yellow-rumped Warbler, Dendroica coronata.
Also photos of the adults, pups and a den.

Fotos / Sons

What

Esganagata (Gasterosteus aculeatus)

Observador

isaac_krone

Data

Setembro 29, 2018 11:44 AM CDT

Fotos / Sons

Observador

kevinhintsa

Data

Outubro 23, 2018 09:54 AM PDT

Descrição

Host plant is a Eucalyptus globulus .

Fotos / Sons

Observador

reinarau

Data

Outubro 25, 2018 07:48 AM PDT

Fotos / Sons

What

Bufa-de-Velha (Pisolithus arhizus)

Observador

milavth

Data

Outubro 21, 2018 10:55 AM PDT

Fotos / Sons

Observador

katatat

Data

Outubro 21, 2018 11:39 AM PDT

Fotos / Sons

Observador

eviloreo

Data

Outubro 1, 2018 11:58 AM EDT

Descrição

In median in parking lot of apartment complex.

Fotos / Sons

Observador

leftcoastnaturalist

Data

Abril 6, 2017 09:45 AM PDT

Fotos / Sons

Observador

ang

Data

Maio 24, 2017 12:26 PM PDT

Fotos / Sons

Observador

connerbridges

Data

Abril 28, 2018 12:06 PM PDT

Fotos / Sons

Observador

danceswithwolves

Data

Abril 28, 2018 01:10 PM PDT

Fotos / Sons

Observador

tiwane

Data

Abril 28, 2018 12:05 PM PDT

Fotos / Sons

Observador

rhjackso

Data

Maio 5, 2018 03:45 PM PDT

Fotos / Sons

What

Lontra-Canadense (Lontra canadensis)

Observador

hailkeepur

Data

Maio 9, 2018 07:41 PM PDT

Fotos / Sons

Observador

pogon

Data

Abril 27, 2018 05:15 PM PDT

Descrição

On purple-leaf plum

Fotos / Sons

Observador

kueda

Data

Abril 28, 2018 09:17 PM PDT

Fotos / Sons

What

Noitibó-de-Nutall (Phalaenoptilus nuttallii)

Observador

antnat

Data

Abril 28, 2018 10:18 PM PDT

Fotos / Sons

Observador

nmcnear

Data

Abril 2018

Fotos / Sons

Observador

damontighe

Data

Abril 27, 2018 09:56 PM PDT

Fotos / Sons

Observador

leptonia

Data

Dezembro 2010

Fotos / Sons

What

Gastrópodes (Classe Gastropoda)

Observador

edoswalt

Data

Fevereiro 4, 2018 11:01 AM PST

Descrição

Eggs like these were mostly scattered inch or more apart; this is a rare clump. Under (I think) cattail fronds in moist area (usually would have standing water this time of year). Each egg approx 2mm long.

Fotos / Sons

Observador

edoswalt

Data

Abril 23, 2014 01:46 PM PDT

Descrição

Let's consider this to be an observation of the lower spider; see other observation for the top spider.

Fotos / Sons

Observador

stephen_sikes

Data

Novembro 26, 2017 11:13 AM PST

Descrição

Base of a Bay Tree

Fotos / Sons

Observador

pogon

Data

Abril 26, 2017 02:27 PM PDT

Descrição

In areas where pine had invaded Nothofagus forest

Fotos / Sons

Observador

moonlittrails

Data

Dezembro 9, 2017 05:07 PM PST

Descrição

Could this be A. asmodaeus (Bond, 2012: known only from type locality Mt. Diablo)?

Est. 2cm BL, found in oak/mixed duff by @leftcoastnaturalist. It was non-responsive, so dead (but soft/flexible) or doing a very good job at playing dead.
More photos at https://bugguide.net/node/view/1476644/bgimage

Etiquetas

Fotos / Sons

Observador

dominic

Data

Março 25, 2016

Descrição

Not sure on ID, but there were a couple of these guys.

Other Animals

Fotos / Sons

What

Animais, Metazoários (Reino Animalia)

Observador

hydrosteve

Data

Agosto 12, 2017 11:58 AM PDT

Descrição

Possible cougar marks in the trail - in what was mud at the top of a steep ravine.

Fotos / Sons

Observador

erwilbongolan

Data

Agosto 26, 2017

Descrição

Iridescent Green Skin.
Wings have a black frosty striped pattern.
Lower part abdomen moves and down to groom itself.
It is next to a road on an invasive berry plant.

Fotos / Sons

What

Campanhol-da-Califórnia (Microtus californicus)

Observador

emjtca

Data

Setembro 2, 2017 07:57 AM PDT

Descrição

So many of them!

Fotos / Sons

Observador

kueda

Data

Outubro 16, 2013 09:29 PM PDT

Descrição

I suspect this is Promyrmekiaphila, but I can't really see the cymbium, let alone any dorsal spines thereupon.

Fotos / Sons

Observador

leptonia

Data

Agosto 2017

Fotos / Sons

What

Ser Humano (Homo sapiens)

Observador

leptonia

Data

Agosto 29, 2017 06:55 PM PDT

Descrição

Found by Daniel Schmelter and co. on cave wall near "Main Hall"
http://i.imgur.com/fmWxoSa.jpg

"Tissue" sampled into CTAB.
Update/edit: I don't think this is fungal, or any other sort of living thing. I think it's glow-in-the dark latex/rubber/goo who-knows-what

Fotos / Sons

Observador

miketroll

Data

Julho 19, 2006

Fotos / Sons

What

Campanhol-da-Califórnia (Microtus californicus)

Observador

accordiongordon

Data

Agosto 21, 2017 11:54 AM PDT

Descrição

Found underneath log, along with several other voles.

Fotos / Sons

Observador

dshamlet

Data

Julho 1, 2017 04:50 PM PDT

Fotos / Sons

What

Vespas-de-Darwin (Família Ichneumonidae)

Observador

michael_hodge

Data

Agosto 22, 2017 09:07 AM CDT

Fotos / Sons

Observador

leptonia

Data

Maio 1, 2016 08:01 AM PDT

Descrição

G. californicum, presumably

Fotos / Sons

Observador

zorzal

Data

Abril 30, 2016 03:47 PM PDT

Fotos / Sons

Observador

direbecca

Data

Abril 19, 2016

Fotos / Sons

Observador

leptonia

Data

Abril 7, 2016 10:27 AM PDT

Fotos / Sons

Observador

flygrl67

Data

Março 2016

Descrição

This was on the ceiling inside my house right above where I work. It was about 2" wide, including its legs, so the main part of it was about 3/4". I photographed it right where it was found on the ceiling, and then my son trapped it in a plastic cup before relocating it outside, and I photographed it in the cup with a white paper towel in the background, which made the details stand out. I couldn't get a shot of its eyes straight on, but it looks from my angle above it in the cup that it had 8 evenly spaced eyes. @rjadams55 , is this a Liocranid? Are those long tarsal claws on its hind legs or not? I was looking at plate 29 on your book, and some of the spiders on that page look similar, but they seem like they are smaller than the one I saw. There's this spider that looks similar (hard to tell w/the quality of this photo) that was also seen in SLO: http://bugguide.net/node/view/488050

Etiquetas

Fotos / Sons

What

Anelídeos (Filo Annelida)

Observador

sassafire

Data

Fevereiro 3, 2016

Descrição

Found in the Mud Flats at Crab Cove; ~2 inches long.

Fotos / Sons

Observador

bluebird101

Data

Janeiro 24, 2016 01:39 PM PST

Descrição

What an awesome find

Fotos / Sons

Observador

flygrl67

Data

Janeiro 2016

Descrição

Habitat: Roadside, Oak Woodland
Substrate: Duff
Cap: 5.5" (14 cm) h x.75" (2 cm) thick, plane, pale butter yellow, translucent, dry, striated at the margin, white warts, sparser toward the center, white flesh, did not discolor, mild smell
Gills: white, adnexed, no latex, no bruising
Stipe: 4" h (10 cm) x 1-1.75" (2.5-4.5 cm) thick solid white, smooth, dry, tapered at the top, pronounced basal bulb, looks like an egg cup (volva), no ring present, no bruising, mild smell, snapped like chalk, very short striations at the very top of stipe

Fotos / Sons

Observador

damontighe

Data

Janeiro 22, 2016 03:11 PM PST

Fotos / Sons

Observador

flygrl67

Data

Janeiro 2015

Descrição

Records on Mushroom Observer of this specimen including spore data: http://goo.gl/vxiYz2

This substantial mushroom was about 7-10 cm high and wide. According to Christian Schwarz, who examined this under a microscope, this is the first record of the genus Entocybe in Santa Cruz county (at least on iNaturalist). Proposed names: Entocybe trachyospora, Entocybe trachyospora var. purpureoviolacea

Please see my original post on Mushroom Observer: http://mushroomobserver.org/observer/show_observation/197555

Fotos / Sons

What

Orelhas-de-pau e Afins (Ordem Polyporales)

Observador

deejay

Data

Outubro 18, 2015

Descrição

Found growing on a possibly diseased plum tree.

Fotos / Sons

Observador

damontighe

Data

Outubro 3, 2015 09:54 AM PDT

Fotos / Sons

Observador

leftcoastnaturalist

Data

Junho 1, 2014 02:06 PM PDT

Fotos / Sons

Observador

kueda

Data

Junho 4, 2015 07:28 PM PDT

Descrição

Tons of these under a log in a drier part of the marsh. Never seen so many. And are those pseudoscorpion eggs?

Fotos / Sons

Observador

kueda

Data

Julho 1, 2015 09:08 PM PDT

Descrição

This one used lichen in its turret construction, a choice that we endorsed whole-heartedly. Also, Trent is the best turret tickler ever.

Fotos / Sons

What

Madeirudo (Boletus edulis)

Observador

jzzipkin

Data

Junho 27, 2015 08:42 AM PDT