Bohemia Ecological Preserve- mixed hardwood/conifer forest with scattered grasslands on serpentine vein, adjacent to Duvoul Creek
Found under Arctostaphylos bakeri, buried amongst duff on the edge of grassland
Sporangia resembling little white tufts on extremely thin, black, hair-like stalks extending in all directions from decomposing Arctostaphylos bakeri flowers
On interior surface of bark from well-decayed alder log under unidentifiable rotting agaric, maybe a Clitocybe? Long fibers along the entire length of stipe, shorter fibers on cap appearing powdery silver, easily brushed away revealing smooth dark cap. Gills with blue UV fluorescence
Mixed hardwood/conifer coastal forest, private property in Gualala
Growing in Pseudotsuga menziesii duff in a stand of young Pseudotsuga menziesii
Pileus peachy to flesh colored, smooth, umbilicate. Lamellae white, broadly attached. Stipe short, equal with thick white rhizomorphs
Smell slightly sweet
Taste farinaceous
KOH mild yellow on cap
On a mossy embankment in a cloud forest at 1800 meters elevation, under Quercus and Liquidambar.
This marten was likely up at 10,900ft/3300m to hunt pikas, but when I stumbled along it became very curious about me. I was able to snap photos for about 8 minutes, then moved on to photograph the flock of rosy finches that was half dosing off while observing the marten. I wasn't able to observe any predation, but may have heard a couple distant screams.
Growing under Chamise in a shallow depression in the soil; mostly Chamise, but there were 2 Pinus sabiniana nearby (closest was about 15'-20' away); no detectable odor; did not taste; KOH rxn negative; observed with @panayotova; this was our second season observing this species in the same exact location (See https://www.inaturalist.org/observations/147170328 for DNA sequenced collection.)
likely "Luteodiscus hemiamyloideus" Baral nom. prov.
Not much scent, at most faint fruit.
spores ~ 9-10 x 5-6 μm
KOH yellow. UV fluorescence on base of stipe (faint green) and bright orange where KOH.
stipe tapered, no bulb
trees in proximity - Pseudotsuga menziesii, Quercus kelloggii
Under Tanoak, Madrone, Doug-Fir, White Fir, Ponderosa Pine. Along creek bank just uphill from sand mt blvd
Leucistic? The pigment in the ocular orbitals is making me hesitate on saying albino
Large, densely cespitose groups in planter with tomatoes and rosemary, appearing after tropical storm. Downy/fuzzy universal veil tissue dense on cap, extending down the stipe, also present on annulus which is weak and falls away easily. Veil tissue very soft to touch, becoming sleek on cap with desiccation. Stipe bases enmeshed in stringy mat of plant roots (both rosemary and tomato.) Strong fungal smell, rotting fruitbodies were attracting flies. Very mild taste, almost flavorless. No UV fluorescence. Even the fresher fruitbodies are weak and floppy, falling over easily without plant/planter wall/other fruitbodies to lean on. Rotten fruitbodies very strong smell, turning black/brown.
Last photo is out of focus, but it shows the thick-edged, forking gills well.
F000278
Very viscid
Largest cap I saw was maybe 1cm
Fruiting in small cluster (5 fruiting bodies) hypogeously near decayed branch. Pinus contorta and Abies magnifica/concolor nearby. Interesting odor, which took some time to develop. It smells like a mixture of leather, feet, and something akin to roasted coffee.
Tricholoma? Pale yellow throughout with some brown discolorations on the cap and gills. Growing under Manzanita with oak nearby
Growing under Quercus agrifolia; KOH rxn last 2 images of the photo set
This is the ITS1/2 for Cortinarius thiersii AAGGATCATTATTGAAATAAACCTGATGGGTTGCTGCTGGCTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGATCTGGATATCTTTCTGAATGCCTGGCATTCGGGTTTGAGGATTGACTTTTGTCTTTCCTTACATTTCCAGGCCTATGTTTTCTTCATATACACCATTTATGTTATAGAATGTAATGAAAAGGGCCTTTGTGCCTACAAACCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAGGTTTTAACTTGTCGAGTGTTTGGATGTGGGGGTCTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTT
Fruiting out of brushtailed possum carcasses
In Bay, Madrone, Tanoak duff. Spores roughly 7 x 5
Found by my friend @graysquirrel
Photo and collection by Heidi Hoelting. Distanct gills, very small. I'm looking for a better photo.
On bare soil at base of chamise.
Wet trailcut soil with Ceanothus, toyon, chamise. Felty grey fibrous cap with depress in center, deeply decurrent gills. Similar to https://www.inaturalist.org/observations/198874667 collected earlier in the same month at the same location, which was much larger and more upright, unclear if the same.
Maybe E. coelestinum or close? Leptonia. In dense litter of Adenostoma sparsifolium. Ceanothus present nearby also but wasn't noticed in duff composition.
.ab1 files located at
https://drive.google.com/drive/folders/15TyOWjsxc54_e8Stad51jS2YPK1mSCPm?usp=sharing
Growing in mixed conifer forest under a yew tree. Pileus matte, powdery lipstick-brick red, with raggedy white veil tissue at margin. Lamellae reddish pink, free. Stripe fibrous, reddish with white scales, bruising dark red easily. K+ black, smell indistinct
Extraordinary thick, extensive mats of mycelium of Marasmius albogriseus really bind this landscape (east-escarpment Island oak groves) together. The steepness and high erosion rates perhaps select against other species. Geastrum fornicatum and Marasmius plicatulus perhaps behave similarly here.
Small nearly black group of 7-8 mushrooms growing on ground in very mature second growth forest
Growing at the base of Artemisia californica. Neither fruit body forming a distinct shelf, pores larger than my P. arctostaphyli collections. Going with P. artemisiae for now, which is known from Artemesia tridentata.
Burned Quercus/Pinus dominant woodland (now shrubland post-burn), just west of Knoxville road near Lake Berryessa
Growing on burned, dead but standing Pinus sabiniana
Reflexed polypore with white hymenophore and surface speckled in brown. Tissue tough, dense, leathery
Taste extremely bitter/acidic
Smell indistinct
Slightly yellow KOH in white light
Whole sporocarp fluorescing blue/yellow/pinkish. KOH turning bright yellow
Two fruiting bodies found within 20 feet of large patches of Microglossum nudipes complex. Fruiting from needle duff unlike all other earth tongues around found fruiting from moss. Second photo compares the two Microglossum sp. on the left with M. nudipes found nearby .
~98% ITS barcode alignment with U.S. M. olivaceum and European M. rufescens
Burned Quercus/Pinus dominant woodland (now shrubland post-burn), just west of Knoxville road near Lake Berryessa
Growing in soil and directly off fine roots in a hole leftover from a burned out root system
Brown pileus with a wavy margin. Lamellae white to cream colored, anastomosing, subdistant to distant, broadly attached to subdecurrent. Stipe short, fibrous, off-center
Smell indistinct
Annadel State Park, Lawndale Trail. Mixed hardwood/conifer forest
Growing on stem of dead Adiantum jordanii
Pinhead-size orange, spherical cups with white margin
INSANE purple staining! Pretty sure it's a basidiomycete. Under tanoak & redwood. Fruiting out of an exposed dirt wall next to a creek. Fruiting body exposed. Nutty smell, and no taste.
Growing from a roadcut under bay. Pileus champagne pink with tightly appressed darker pink scales. Lamellae light pink, widely attached. Stipe pink, smooth, with slight white basal tomentum
Found by Victoria; SDNWR intern.
C. cf. muscigena?
under Chamaebatia australis and Ceanothus tomentosus
FDS-CA-00750
Mixed hardwood/conifer coastal forest near the south fork of the Gualala River
Growing on dead Arbutus menziesii leaves fallen near the side of dirt road. Studding the underside with affinity for the central vein
Tiny orange spheres. Hard to the touch. Endophytes?
Annadel State Park, just off Lawndale Trail in an inland stand of young Sequoia sempervirens
Growing just downhill of a burnt Sequoia sempervirens log in a stand of young Sequoia sempervirens. Looks as if there was a relatively mild burn in the area within the past decade. Maybe a low-intensity patch from the 2017 Tubbs fire
Royal blue, velutinous pileus. Lamellae white with a blue hue, narrowly attached. Stipe elongate, equal, royal blue covered in fine chevrons
Smell indistinct
Whole fruit body glows golden
Dark purple cap,
Purple stipe,
Glutinous partial veil,
White gills,
Viscid,
Indistinct odor,
No KOH; flouresces yellow,
White UV on gills/White parts of stipe,
Bitter taste,
Growing trailside in mossy soil,
Near sitka spruce
I realize these photos are of the Yeti-hiding-behind-a-snowbank-on-a distant-mountain-next-to-Elvis in quality, but they are of diminutive fish photographed in Devils Hole and the Devils Hole Pupfish is the only species found in this small crack in the Earth.
To see the Devils Hole Pupfish, one enters a space entirely surrounded by barbed wire, and then walks down a long tunnel that completely encloses you in heavy, tight meshed, metal fencing. From here, 60 ft above and back from Devils Hole, with binoculars, you can see the tiny (0.75") fish swimming over the limestone ledge that provides both a feeding and spawning ground. Any attempt to photograph the fish requires that you photograph them from inside the cage making it impossible to catch any fine details. I was able to see quite a few of them chasing each other and swimming about. In these photos, Devils Hole Pupfish can be seen as they cross the ledge.
Maybe. CM24-03458.
Tingo Maria, Leoncio Prado Province, Department of Huánuco, Peru.
totally bizarre... Caulorhiza...???
Primarily oaks here, and a few nearby madrones.
Growing from soil in a CA bay transition zone from redwood dominated to oak dominated forest
Colony of Neobarya growing on Cortinarius